ID: 1118425138_1118425144

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1118425138 1118425144
Species Human (GRCh38) Human (GRCh38)
Location 14:65652292-65652314 14:65652333-65652355
Sequence CCCTCTGCTAGGATGGCTGTGCG CAATATAAGAGGAAGTTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 4, 4: 107} {0: 1, 1: 0, 2: 0, 3: 11, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!