ID: 1118426186_1118426196

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1118426186 1118426196
Species Human (GRCh38) Human (GRCh38)
Location 14:65665908-65665930 14:65665930-65665952
Sequence CCACAGACACTGGGGCCTATCGG GAGGGTGGACAATGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 13, 3: 48, 4: 174} {0: 1, 1: 34, 2: 296, 3: 1488, 4: 3133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!