ID: 1118452997_1118452999

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1118452997 1118452999
Species Human (GRCh38) Human (GRCh38)
Location 14:65920950-65920972 14:65920966-65920988
Sequence CCTGAGTCCTGGGCAGGAAGGTG GAAGGTGCCGCATAGACACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!