ID: 1118463870_1118463872

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1118463870 1118463872
Species Human (GRCh38) Human (GRCh38)
Location 14:66013621-66013643 14:66013637-66013659
Sequence CCAAAACCTTCGTTGCGATGACC GATGACCTTTTTGTGCCCGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 6, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!