ID: 1118463871_1118463879

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1118463871 1118463879
Species Human (GRCh38) Human (GRCh38)
Location 14:66013627-66013649 14:66013665-66013687
Sequence CCTTCGTTGCGATGACCTTTTTG GCCGCCGATGTGAGGCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 31} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!