ID: 1118522053_1118522061

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1118522053 1118522061
Species Human (GRCh38) Human (GRCh38)
Location 14:66596485-66596507 14:66596507-66596529
Sequence CCCCTGTCAGCCTTTCTCCCATC CCTCTTTGGTACCCAAAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 418} {0: 1, 1: 0, 2: 2, 3: 58, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!