ID: 1118524233_1118524238

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1118524233 1118524238
Species Human (GRCh38) Human (GRCh38)
Location 14:66621858-66621880 14:66621901-66621923
Sequence CCAGCTGCTTTCATTGGCTAGTA CAGGCACACAGTGCTGTCGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 32, 3: 286, 4: 648} {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!