ID: 1118525428_1118525431

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1118525428 1118525431
Species Human (GRCh38) Human (GRCh38)
Location 14:66635228-66635250 14:66635246-66635268
Sequence CCTTAGATGTTACACTGCCACAT CACATTCCATTGGTCAAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103} {0: 1, 1: 1, 2: 5, 3: 33, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!