ID: 1118533909_1118533921

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1118533909 1118533921
Species Human (GRCh38) Human (GRCh38)
Location 14:66737229-66737251 14:66737263-66737285
Sequence CCTTCCTCTTTCTTTTTCCCCTT CTTTCGGGCTTTTGAGTGAATGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 35, 3: 530, 4: 3647} {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!