ID: 1118535192_1118535193

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1118535192 1118535193
Species Human (GRCh38) Human (GRCh38)
Location 14:66756007-66756029 14:66756056-66756078
Sequence CCTCTCTTTATTATAAGTTGTAT TCTCCTTTACCTCTAACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 328} {0: 1, 1: 0, 2: 3, 3: 35, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!