ID: 1118552638_1118552640

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1118552638 1118552640
Species Human (GRCh38) Human (GRCh38)
Location 14:66972531-66972553 14:66972566-66972588
Sequence CCATCCTTTGGTATGCAGAAGTA GCCCCATTTTGTCACATTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 165} {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!