ID: 1118570251_1118570253

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1118570251 1118570253
Species Human (GRCh38) Human (GRCh38)
Location 14:67187749-67187771 14:67187763-67187785
Sequence CCTCTGTGCCTTTGCTCAGACTG CTCAGACTGACTAATCTTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!