ID: 1118571563_1118571573

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1118571563 1118571573
Species Human (GRCh38) Human (GRCh38)
Location 14:67199998-67200020 14:67200029-67200051
Sequence CCATGGACCTCATGGTTTAGGAC TCTGGACACCCAGGCTCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 98} {0: 1, 1: 1, 2: 3, 3: 40, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!