ID: 1118611592_1118611595

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1118611592 1118611595
Species Human (GRCh38) Human (GRCh38)
Location 14:67545188-67545210 14:67545221-67545243
Sequence CCTTTAAGTTAGTGACTCGGAGG TTCTTCTGCTGATATGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 75} {0: 1, 1: 0, 2: 2, 3: 14, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!