ID: 1118611829_1118611837

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1118611829 1118611837
Species Human (GRCh38) Human (GRCh38)
Location 14:67547408-67547430 14:67547458-67547480
Sequence CCTAGCAGAGCCAAGACAAGTTA TTCTTAGGAGAGCTCCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 273} {0: 1, 1: 0, 2: 3, 3: 9, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!