ID: 1118611830_1118611837

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1118611830 1118611837
Species Human (GRCh38) Human (GRCh38)
Location 14:67547418-67547440 14:67547458-67547480
Sequence CCAAGACAAGTTATAGATCGCAG TTCTTAGGAGAGCTCCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51} {0: 1, 1: 0, 2: 3, 3: 9, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!