ID: 1118628739_1118628745

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1118628739 1118628745
Species Human (GRCh38) Human (GRCh38)
Location 14:67683591-67683613 14:67683614-67683636
Sequence CCCTGTTTGCCTCTAATCAAAAG AGTAAAAATGAAGGGATAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170} {0: 1, 1: 0, 2: 4, 3: 38, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!