ID: 1118628739_1118628746

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1118628739 1118628746
Species Human (GRCh38) Human (GRCh38)
Location 14:67683591-67683613 14:67683618-67683640
Sequence CCCTGTTTGCCTCTAATCAAAAG AAAATGAAGGGATAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170} {0: 1, 1: 0, 2: 10, 3: 120, 4: 1269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!