ID: 1118636977_1118636978

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1118636977 1118636978
Species Human (GRCh38) Human (GRCh38)
Location 14:67756961-67756983 14:67756978-67757000
Sequence CCTTTCTCAGTCTGTGTCTCCAT CTCCATTCTTTTAGTTGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 624} {0: 1, 1: 1, 2: 14, 3: 71, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!