ID: 1118657723_1118657728

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1118657723 1118657728
Species Human (GRCh38) Human (GRCh38)
Location 14:67970184-67970206 14:67970227-67970249
Sequence CCACTGCCAGTTATTTTTTGCTG AATTAATGGTAGCAGTAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 343} {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!