ID: 1118663456_1118663463

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1118663456 1118663463
Species Human (GRCh38) Human (GRCh38)
Location 14:68040714-68040736 14:68040759-68040781
Sequence CCAGAACTTACCTGGGTAAGGTC AGCATTCTTAGAGAATCACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71} {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!