ID: 1118667340_1118667342

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1118667340 1118667342
Species Human (GRCh38) Human (GRCh38)
Location 14:68085385-68085407 14:68085398-68085420
Sequence CCTAGTATAGCAACCTTATGAGC CCTTATGAGCAGCTTTTTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55} {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!