ID: 1118693071_1118693076

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1118693071 1118693076
Species Human (GRCh38) Human (GRCh38)
Location 14:68359024-68359046 14:68359049-68359071
Sequence CCCCACAGAGGAGCAGCTGCCAC TGGAGCACACCCCACCTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 315} {0: 1, 1: 0, 2: 2, 3: 17, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!