ID: 1118696857_1118696866

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1118696857 1118696866
Species Human (GRCh38) Human (GRCh38)
Location 14:68394261-68394283 14:68394301-68394323
Sequence CCATCTGCAGGGGCTGCTGGGCT CGGGCTCGCCAGCTGGCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 481} {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!