ID: 1118696911_1118696922

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1118696911 1118696922
Species Human (GRCh38) Human (GRCh38)
Location 14:68394667-68394689 14:68394702-68394724
Sequence CCTCTCCCAAGGTATCTACTTTA CTCCCCCAGTGGGTTTTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 147} {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!