ID: 1118716652_1118716660

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1118716652 1118716660
Species Human (GRCh38) Human (GRCh38)
Location 14:68564644-68564666 14:68564670-68564692
Sequence CCTCACAGGGCTCCCCACCACCA GGGCACCTTCCCAAGAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 443} {0: 1, 1: 0, 2: 0, 3: 22, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!