ID: 1118721397_1118721406

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1118721397 1118721406
Species Human (GRCh38) Human (GRCh38)
Location 14:68596835-68596857 14:68596876-68596898
Sequence CCCGTCAGGGGCAGACATTGGCA GGGGAGTGCAGCTGTCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 114} {0: 1, 1: 0, 2: 1, 3: 33, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!