ID: 1118725042_1118725049

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1118725042 1118725049
Species Human (GRCh38) Human (GRCh38)
Location 14:68623038-68623060 14:68623080-68623102
Sequence CCCAAGCTCACGGGAGGCAAGGG TACCTTCTTTTTCTCATAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137} {0: 1, 1: 0, 2: 2, 3: 20, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!