ID: 1118725044_1118725052

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1118725044 1118725052
Species Human (GRCh38) Human (GRCh38)
Location 14:68623039-68623061 14:68623087-68623109
Sequence CCAAGCTCACGGGAGGCAAGGGG TTTTTCTCATAAGAGGGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135} {0: 1, 1: 0, 2: 11, 3: 25, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!