ID: 1118728521_1118728530

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1118728521 1118728530
Species Human (GRCh38) Human (GRCh38)
Location 14:68649945-68649967 14:68649984-68650006
Sequence CCAAGGGCTGCCTCGCTATGGTG GGCTCCTGAGAGCCACCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 102} {0: 1, 1: 0, 2: 1, 3: 36, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!