ID: 1118730882_1118730889

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1118730882 1118730889
Species Human (GRCh38) Human (GRCh38)
Location 14:68665496-68665518 14:68665511-68665533
Sequence CCCATCCCAAACTGTGTCTATAA GTCTATAATCAGGCTCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195} {0: 1, 1: 0, 2: 1, 3: 5, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!