ID: 1118768874_1118768881

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1118768874 1118768881
Species Human (GRCh38) Human (GRCh38)
Location 14:68928679-68928701 14:68928729-68928751
Sequence CCATTTAGTAAGTGCTCAGTGAA TAGCTCCCCCAAAATGATCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 358} {0: 1, 1: 0, 2: 2, 3: 11, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!