ID: 1118797935_1118797943

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1118797935 1118797943
Species Human (GRCh38) Human (GRCh38)
Location 14:69161027-69161049 14:69161066-69161088
Sequence CCCATCTCTACTAAAAATGCAAA TGGTGGGCGCCTGTAAGTCCAGG
Strand - +
Off-target summary {0: 2282, 1: 93703, 2: 242781, 3: 155312, 4: 85843} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!