ID: 1118810145_1118810151

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1118810145 1118810151
Species Human (GRCh38) Human (GRCh38)
Location 14:69267201-69267223 14:69267239-69267261
Sequence CCCCTAAACTTCAGATGCGCCTT TAGAGACAGTATGGTCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67} {0: 1, 1: 0, 2: 0, 3: 16, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!