ID: 1118837230_1118837238

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1118837230 1118837238
Species Human (GRCh38) Human (GRCh38)
Location 14:69485588-69485610 14:69485606-69485628
Sequence CCTGGCCCTTCTGAAAGGCTCAG CTCAGGCTAAGGAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 241} {0: 1, 1: 0, 2: 8, 3: 97, 4: 1065}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!