ID: 1118840323_1118840332

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1118840323 1118840332
Species Human (GRCh38) Human (GRCh38)
Location 14:69505091-69505113 14:69505104-69505126
Sequence CCTCCCTTAATGCCACAGCACAG CACAGCACAGGGAAGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162} {0: 1, 1: 1, 2: 9, 3: 95, 4: 779}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!