ID: 1118866112_1118866113

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1118866112 1118866113
Species Human (GRCh38) Human (GRCh38)
Location 14:69704905-69704927 14:69704927-69704949
Sequence CCATTGTGCTTATTGCTTTGCAT TACATTATCTTAATCCTCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 395} {0: 1, 1: 0, 2: 3, 3: 13, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!