ID: 1118872137_1118872145

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1118872137 1118872145
Species Human (GRCh38) Human (GRCh38)
Location 14:69752386-69752408 14:69752407-69752429
Sequence CCACCCAATATTTCCAATTGTCC CCCTTTGTTTGGGGCCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 174} {0: 1, 1: 0, 2: 1, 3: 27, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!