ID: 1118889594_1118889601

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1118889594 1118889601
Species Human (GRCh38) Human (GRCh38)
Location 14:69897080-69897102 14:69897097-69897119
Sequence CCCAGATGTGATCCAGGAACATT AACATTCCATGGAACTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 206} {0: 1, 1: 0, 2: 0, 3: 21, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!