ID: 1118931647_1118931661

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1118931647 1118931661
Species Human (GRCh38) Human (GRCh38)
Location 14:70247492-70247514 14:70247541-70247563
Sequence CCTTTGCACTTCTGCCCCTGCTG CAGGGAAGTGAAATGCTGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 31, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!