ID: 1118931651_1118931662

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1118931651 1118931662
Species Human (GRCh38) Human (GRCh38)
Location 14:70247507-70247529 14:70247542-70247564
Sequence CCCTGCTGATCACCTTCAAGGGG AGGGAAGTGAAATGCTGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 78, 4: 640}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!