ID: 1118931654_1118931662 |
View in Genome Browser |
Spacer: 0 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1118931654 | 1118931662 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 14:70247519-70247541 | 14:70247542-70247564 |
| Sequence | CCTTCAAGGGGATCACCACTTCC | AGGGAAGTGAAATGCTGGGAGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 1, 2: 4, 3: 78, 4: 640} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||