ID: 1118960376_1118960382

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1118960376 1118960382
Species Human (GRCh38) Human (GRCh38)
Location 14:70524605-70524627 14:70524638-70524660
Sequence CCTGCTGATCACCTTCAAAGGGA TGGAGAAGTGAAATACTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 10, 4: 105} {0: 1, 1: 0, 2: 0, 3: 24, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!