ID: 1118964892_1118964894

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1118964892 1118964894
Species Human (GRCh38) Human (GRCh38)
Location 14:70571598-70571620 14:70571613-70571635
Sequence CCATGCCTATACAACATAGTACT ATAGTACTGAAAGTCCTAGCTGG
Strand - +
Off-target summary No data {0: 9, 1: 42, 2: 97, 3: 167, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!