ID: 1118971596_1118971608

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1118971596 1118971608
Species Human (GRCh38) Human (GRCh38)
Location 14:70642222-70642244 14:70642246-70642268
Sequence CCCGGGCGGCGGCGGAGGAGCCC AGCGAGGGGCCAGGTCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 436} {0: 1, 1: 0, 2: 2, 3: 28, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!