ID: 1118974668_1118974673

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1118974668 1118974673
Species Human (GRCh38) Human (GRCh38)
Location 14:70666311-70666333 14:70666329-70666351
Sequence CCACCATGAGACCTGCCTGCCAT GCCATAGCTTCCTCTTGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 197} {0: 1, 1: 0, 2: 3, 3: 38, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!