ID: 1118974668_1118974675

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1118974668 1118974675
Species Human (GRCh38) Human (GRCh38)
Location 14:70666311-70666333 14:70666338-70666360
Sequence CCACCATGAGACCTGCCTGCCAT TCCTCTTGCCTGGGACACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 197} {0: 1, 1: 0, 2: 1, 3: 41, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!