ID: 1118983798_1118983804

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1118983798 1118983804
Species Human (GRCh38) Human (GRCh38)
Location 14:70736160-70736182 14:70736195-70736217
Sequence CCCACACCATGAAAGAATCTTAA GTTTAAGCCAAGACAGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 278} {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!