ID: 1118984013_1118984022

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1118984013 1118984022
Species Human (GRCh38) Human (GRCh38)
Location 14:70738267-70738289 14:70738294-70738316
Sequence CCTTCTGACCAAGCGTCCCTGGC ACGTCCGTCCCTTCTTCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 109} {0: 1, 1: 0, 2: 0, 3: 1, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!