ID: 1118989837_1118989848

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1118989837 1118989848
Species Human (GRCh38) Human (GRCh38)
Location 14:70787862-70787884 14:70787910-70787932
Sequence CCACCAAACACCTGGGCTGCTAC TGTGAGGGGAGACAGAGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 145} {0: 1, 1: 0, 2: 5, 3: 78, 4: 699}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!